.. metaRNA documentation master file, created by sphinx-quickstart on Fri Apr 22 00:21:17 2016. You can adapt this file completely to your liking, but it should at least contain the root `toctree` directive. metaRNA, find target sites for the miRNAs ========================================= metaRNA finds potential target sites for the microRNAs in genomic sequences. * Written in Python * Built on miRanda_. It is built on miRanda, an algorithm for detection and ranking of the targets of microRNA. .. _miRanda: http://www.microrna.org/microrna/getDownloads.do Quickstart ---------- .. code:: python from metarna.target_scan import scan, free_energy gene_sequence = ( "ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC" "CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC" "CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG" ) mirna_sequence = "UGGCGAUUUUGGAACUCAAUGGCA" # Get free Energy value: delta_g = free_energy(gene_sequence, mirna_sequence) # Get full targets information: targets = scan(gene_sequence, mirna_sequence) # Specifying Calculation Parameters targets = scan(gene_sequence, mirna_sequence, scale=5.0) Contents .. toctree:: :maxdepth: 2 installation parameters getting-started Indices and tables ================== * :ref:`genindex` * :ref:`modindex` * :ref:`search`