metaRNA, find target sites for the miRNAs¶

metaRNA finds potential target sites for the microRNAs in genomic sequences.

Written in Python
Built on miRanda.

It is built on miRanda, an algorithm for detection and ranking of the targets of microRNA.

Quickstart¶

from metarna.target_scan import scan, free_energy

gene_sequence = (
    "ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC"
    "CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC"
    "CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG"
)

mirna_sequence = "UGGCGAUUUUGGAACUCAAUGGCA"

# Get free Energy value:
delta_g = free_energy(gene_sequence, mirna_sequence)

# Get full targets information:
targets = scan(gene_sequence, mirna_sequence)

# Specifying Calculation Parameters
targets = scan(gene_sequence, mirna_sequence, scale=5.0)

Contents

Installing¶

Using PyPi¶

metaRNA can be installed very easily using pip.

pip install metarna

Using git¶

If you want to run the very latest, feel free to pull down the repo from github and install by hand.

git clone https://github.com/prashnts/metaRNA.git
cd metaRNA
python setup.py install

You can run the tests using the test-runner:

python setup.py test

Browse the source code online at https://github.com/prashnts/metaRNA

Pre-requisite¶

ViennaRNA is required to compile metaRNA C extensions. It is recommended to install ViennaRNA from source. On Unix-like systems, it usually involves:

wget 'http://www.tbi.univie.ac.at/RNA/download/sourcecode/2_2_x/ViennaRNA-2.2.10.tar.gz' -O viennarna.tar.gz
mkdir viennarna
tar -zxvf viennarna.tar.gz -C viennarna --strip-components=1
cd viennarna
./configure
make
sudo make install

Usual build essentials (automake, autoconf, gcc) are required.

You can download the above package from this link if the above link isn’t accessible. To download and verify the SHA checksum:

wget "https://noop.pw/etc/vienna224.tar.gz" -O vienna224.tar.gz
echo "71a4c4704228fd01eb6e39415400a904d5240cef  vienna224.tar.gz" | shasum -c

Windows System¶

metaRNA hasn’t been tested or built on Windows systems yet. Contributions are welcome.

Calculation Parameters¶

miRanda algorithm used by metaRNA accepts the following optional parameters.

Parameter	Type	Default	Description
scale	float	4.0	The 5’ miRNA scaling parameter.
strict	int	0	Perform a Strict Seed search when set to 1.
gap_open	float	-9.0	Gap-open Penalty
gap_extend	float	-4.0	Gap-extend Penalty
score_threshold	float	50.0	Score Threshold for reporting hits
energy_threshold	float	1.0	Energy Threshold for reporting hits
length_5p_for_weighting	int	8	The 5’ sequence length to be weighed except for the last residue.
temperature	int	30	Used while calculating Free Energy
alignment_len_threshold	int	8	Minimum alignment.

Passing Parameters¶

The parameters are passed as keyword arguments.

targets = scan(gene_sequence, mirna_sequence, scale=5.0, strict=1)